Objective   To investigate the effects of 10-23 deoxyribozyme (DRz) targeting the mRNA of isocitrate lyase gene (icl) which play an important role in the persist of Mycobacterium tuberculosis (Mtb) in host macrophage on the infection of the bacterium and the therapeutic effects of 10-23DRz alone or combined with isoniazidum (INH) on mice tuberculosis.    Methods   According to our previous study

DZ4 (TGAACTGGAAGGCTAGCTACAACGATTGAAGCCC) was identified with the highest cleavage activity among the 10-23 DRz. DZ4-S

with all base pairs of DZ4 but wrong order

DZ4-polyG and DZ4-FITC were synthesized and served as control. Mtb were pretreated with DZ4 (5 μmol/L)

or INH (10 μg /L)

or INH+DZ4 or INH+DZ4-S

and then used to infect BALB/c mice. The lungs of infected mice were harvested to make Mtb culture at the time of 2

4

8 and 12 weeks after the infection. The histopathological changes of lungs were observed at 12 weeks after the infection. DZ4-FITC was used to detect the effects of intranasal administration. BALB/c mice were injected intravenously with Mtb H37Rv strain to make the animal model of tuberculosis. Then the infected mice were treated through intranasal administration with normal saline (50 μl)

or INH [5  mg/(kg·d) for 4 weeks]

or DZ4 (20 μmol/L

total 50 μl

once per week

for 3 weeks)

or INH+DZ4

or INH+DZ4-polyG. Mice were sacrificed in 2 weeks after the end of therapy

and lungs were harvested to quantitate the viable mycobacteria in the lungs and histopathological examination.    Results   The viable Mtb in the lungs of all infected mice had no significant difference at 2 weeks after the infection (P0.05). But at 4 to 12 weeks after the infection

the mice infected with Mtb pretreated with INH+DZ4 had significantly minor viable Mtb in their lungs compared with the other groups (P0.05). The pulmonary lesions of INH+DZ4 group were also obviously slighter than other groups. At 4 h after intranasal administration with DZ4-FITC

the frozen section of the lungs emitted bright fluorescence and sustained for at least 48 h. Data from the therapeutic experiment showed that the viable Mtb and histopathological change in the lungs had no obvious difference between DZ4 and normal saline treatment group. So did the INH+DZ4

INH+DZ4-polyG and INH treatment group.    Conclusion   10-23DRz targeting icl mRNA efficiently resists the infection of Mtb in mice when combined with INH. 10-23DRz has no therapeutic effect on mice tuberculosis and fails to enhance the therapeutic effects of INH in this research.